Subsequence

From Free net encyclopedia

In mathematics, a subsequence of some sequence is a new sequence which is formed from the original sequence by deleting some of the elements without disturbing the relative positions of the remaining elements.

Formally, suppose that X is a set and that (ak)kK is a sequence in X, where K = {1,2,3,...,n} if (ak) is a finite sequence and K = N if (ak) is an infinite sequence. Then, a subsequence of (ak) is a sequence of the form <math> (a_{n_r}) </math> where (nr) is a strictly increasing sequence in the index set K.

Contents

Example

As an example,

<math> < B,C,D,B > </math>

is a subsequence of

<math> < A,C,B,D,E,G,C,E,D,B,G > </math>,

with corresponding index sequence <3,7,9,10>.

Given two sequences X and Y, a sequence G is said to be a common subsequence of X and Y, if G is a subsequence of both X and Y. For example, if

<math> X = < A,C,B,D,E,G,C,E,D,B,G > </math> and
<math> Y = < B,E,G,C,F,E,U,B,K > </math>

then common subsequence of X and Y could be

<math> G = < B,E,E > </math>

This would not be the longest common subsequence, since G only has length 3, and the common subsequence < B,E,E,B > has length 4. The longest common subsequence of X and Y is < B,E,G,C,E,B >

Applications

Subsequences have applications to computer science, especially in the discipline of Bioinformatics, where computers are used to compare, analyze, and store DNA strands.

Take two strands of DNA, say :

ORG1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
ORG2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA

Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.

Substring vs. subsequence

In computer science, string is often used as a synonym for sequence, but it is important to note that substring and subsequence are not synonyms. Substrings are consecutive parts of a string, while subsequences need not be. This means that a substring of a string is always a subsequence of the string, but the opposite is not true.Template:Ref

See also

References

| last = Gusfield
| first = Dan
| origyear = 1997
| year = 1999
| title = Algorithms on Strings, Trees and Sequences: Computer Science and Computational Biology
| publisher = Cambridge University Press
| location = USA
| id = ISBN 0-521-58519-8
| pages = 4

}}

Template:Planetmath